View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_34 (Length: 235)
Name: NF0440_1D_low_34
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 13 - 235
Target Start/End: Complemental strand, 42154997 - 42154774
Alignment:
| Q |
13 |
gaatagaaaaggtatgctagagtatttgattcttccaagctctatttatgagataaattacaatacctttataattactcgatacttggtatttttctat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
42154997 |
gaatagaaaaggtatgctagagtatttgat-cttccaagctctatttatgagataaattacaatacctttataattacttgatacttagtatttttctat |
42154899 |
T |
 |
| Q |
113 |
ctttagcaattcaattggtcttgtctaaatatcatagtcaattcaaggtgcacaaattttcttcttttgtaa--ttta-taaccaaaaatatgaaatggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || | ||||||||||||| |||||| |
|
|
| T |
42154898 |
ctttagcaattcaattggtcttgtctaaatatcatagtcaattcaaggtgcacaaattttcttctttttaaaagttcacaaaccaaaaatatg-aatggt |
42154800 |
T |
 |
| Q |
210 |
gtcaatctttactagtccattataat |
235 |
Q |
| |
|
|||||||||| |||| |||||||||| |
|
|
| T |
42154799 |
gtcaatcttttctagcccattataat |
42154774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University