View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_38 (Length: 223)
Name: NF0440_1D_low_38
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440_1D_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 50 - 217
Target Start/End: Complemental strand, 1807102 - 1806935
Alignment:
Q |
50 |
ttagtggttggattaatatttactcgtttgtccatatttaaaatataatcaacaacatcttaaaccttagctcaaaccagtcgagcttcttggaggatat |
149 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1807102 |
ttagtggttggattaatatttactcgtttgtccatatttaaaatagaatcaacaacatcttaaaccttagctcaaaccagtcgagcttcttggaggatat |
1807003 |
T |
 |
Q |
150 |
atgtaatgactttgtttatataatatctttactatcgtatttacagtcacatcagtcatgtttgatgt |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1807002 |
atgtaatgactttgtttatataatatctttactatcgtatttacagtcacatcagtcatgtttgatgt |
1806935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University