View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_39 (Length: 222)
Name: NF0440_1D_low_39
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 214
Target Start/End: Original strand, 2206069 - 2206276
Alignment:
| Q |
7 |
gatgtaaccatctccatggggataccatcgaacttgacgattataggatggttattacttattagagcaaccaagagcgtgaaccatgaaaaagataact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2206069 |
gatgtaaccatctccatggggataccatcgaacttgacgattataggatggttattacttattagagcaaccaagagcgtgaaccatggaaaagataacc |
2206168 |
T |
|
| Q |
107 |
attaaccaaatttcaagtatctttcttcatattttaaagaatttcttcattcatgttcctcaaaatctcataccaaattactatgagaagtagtcgtgcc |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2206169 |
attaaccaaatttcaagtttctttcttcatgttttaaagaatttcttcattcatgttcctcaaaatctcataccaaattactatgagaagtagtcgtgcc |
2206268 |
T |
|
| Q |
207 |
ttattcat |
214 |
Q |
| |
|
|||||||| |
|
|
| T |
2206269 |
ttattcat |
2206276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University