View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_41 (Length: 221)
Name: NF0440_1D_low_41
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 57 - 215
Target Start/End: Complemental strand, 25878589 - 25878431
Alignment:
| Q |
57 |
gggaaaaatagtcatattaatagagtaaaagtatgagcaaccttatttatttattgttgaataaactttaccacttattcaaagttatactcacttcatg |
156 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| | || ||||||||| |
|
|
| T |
25878589 |
gggaaaaatagtcatattagtagagtaaaattatgagcaaccttatttatttatctttgaataaactttaccacttattcaaagctctagtcacttcata |
25878490 |
T |
|
| Q |
157 |
tataaagtggctcgcataaagatcatacactctagagagttggggaaggatctaaagtt |
215 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
25878489 |
tataaagtggctcgcataaagttcatacgctctagagagttggggaaggacctaaagtt |
25878431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University