View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440_1D_low_41 (Length: 221)

Name: NF0440_1D_low_41
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440_1D_low_41
NF0440_1D_low_41
[»] chr8 (1 HSPs)
chr8 (57-215)||(25878431-25878589)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 57 - 215
Target Start/End: Complemental strand, 25878589 - 25878431
Alignment:
57 gggaaaaatagtcatattaatagagtaaaagtatgagcaaccttatttatttattgttgaataaactttaccacttattcaaagttatactcacttcatg 156  Q
    ||||||||||||||||||| |||||||||| |||||||||||||||||||||||  |||||||||||||||||||||||||||| | || |||||||||     
25878589 gggaaaaatagtcatattagtagagtaaaattatgagcaaccttatttatttatctttgaataaactttaccacttattcaaagctctagtcacttcata 25878490  T
157 tataaagtggctcgcataaagatcatacactctagagagttggggaaggatctaaagtt 215  Q
    ||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||||    
25878489 tataaagtggctcgcataaagttcatacgctctagagagttggggaaggacctaaagtt 25878431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University