View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_44 (Length: 216)
Name: NF0440_1D_low_44
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 53267616 - 53267411
Alignment:
| Q |
1 |
aataaatttttacttcgaatgaacttaagaactgatttaacattacaaaattgtgcatgtgaagtttttaaaatggaggaggtacggttgaactaaaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267616 |
aataaatttttacttcgaatgaacttaagaactgatttaacattacaaaattgtgcatgtgaagtttttaaaatggaggaggtacggttgaactaaaacg |
53267517 |
T |
|
| Q |
101 |
tggatgccattaagagcgagtacaaaggacaatatctcagccttaggggtgtgcactatcaatatgagtatattatccataaactcaacccagaaatttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
53267516 |
tggatgccattaagagcgagtacaaaggacaatatctcagccttaggggtgtgctgtatcaatatgagtatattatccataaactcaacccagaaacttc |
53267417 |
T |
|
| Q |
201 |
accttc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
53267416 |
accttc |
53267411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University