View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_1D_low_47 (Length: 205)
Name: NF0440_1D_low_47
Description: NF0440_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_1D_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 85 - 191
Target Start/End: Original strand, 50421207 - 50421313
Alignment:
| Q |
85 |
gcatgaatattcctcctatattctttttgagttaacaatttgagaaaaagagtgactagaacttgagtcatcaagctcgatacctaaaatctcttccttg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50421207 |
gcatgaatattcctcctatattctttttgagttaacaatttgagaaaaagagtgactagaacttgagtcatcaagctcgatacctaaaatctcttcctta |
50421306 |
T |
 |
| Q |
185 |
atgtcca |
191 |
Q |
| |
|
||||||| |
|
|
| T |
50421307 |
atgtcca |
50421313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University