View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_2D_low_28 (Length: 292)
Name: NF0440_2D_low_28
Description: NF0440_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0440_2D_low_28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 6704031 - 6703754
Alignment:
| Q |
19 |
acatacaaattaatcatcatatttatgtgcacgaggccatgcattgagtgatattattatccattagtgtatatgtgccattatggtgtgtccaccatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6704031 |
acatacaaattaatcatcatatttatgtgcacgaggccatgcattgagtgatattattatccattagtgtatatgtgccattatggtgtgtccaccatga |
6703932 |
T |
 |
| Q |
119 |
atgaaactttgaa-tacttcatgcacacacttcattatcgaattacatcactactacttgttgcctcattattacttaataaaggtttgaatccttacaa |
217 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6703931 |
atgcaactttgaaatacttcatgcacacacttcattatcgaattacaccactactacttgttgcctcataattacttaataaaggtttgaatccttacaa |
6703832 |
T |
 |
| Q |
218 |
gaaacggggtagcatatacattggatctttaaataatcatgcatgctctta---agatatctatagctagatctgacc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6703831 |
gaaacggggtagcatatacattggatctttaaataatcatgcatgctcttaattagatatctatagctagatctgacc |
6703754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University