View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_2D_low_36 (Length: 237)
Name: NF0440_2D_low_36
Description: NF0440_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440_2D_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 47414940 - 47415158
Alignment:
Q |
17 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
47414940 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtggtaccctcagagccagccgcaatgatg |
47415039 |
T |
 |
Q |
117 |
ctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttga |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47415040 |
atgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttga |
47415139 |
T |
 |
Q |
217 |
ttaggtcatggttcatatc |
235 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
47415140 |
ttaggtcatggttcatatc |
47415158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 47398296 - 47398502
Alignment:
Q |
17 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg |
116 |
Q |
|
|
|||||||||||| |||||||||||||| ||| |||| || || || |||||||||||||||| ||| ||||||||||||||||||||||| || ||||| |
|
|
T |
47398296 |
gagatgagaggcgaaggagttgagatgttcagtggacttggacccaaggaagtcgagaagctcttgttgtgtgggaccctcagagccagcagcgttgatg |
47398395 |
T |
 |
Q |
117 |
ctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttga |
216 |
Q |
|
|
|| ||||||| ||| | ||| |||||||||||||||||||||||||||| | ||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
T |
47398396 |
cttagcacggtgtgtagcgtcaaaggcgaaaacacaacattcttttctttaaaattttgtttggagaacaaatggctggccatggtcatggaaaccttgg |
47398495 |
T |
 |
Q |
217 |
ttaggtc |
223 |
Q |
|
|
||||||| |
|
|
T |
47398496 |
ttaggtc |
47398502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 84 - 222
Target Start/End: Complemental strand, 46543179 - 46543041
Alignment:
Q |
84 |
tgtgtgggaccctcagagccagccgcaatgatgctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggaga |
183 |
Q |
|
|
|||||||||||||||| ||| |||||||| ||||||||||| ||||| | |||| || ||||||||||| ||||||||||||| ||||| |||||||| |
|
|
T |
46543179 |
tgtgtgggaccctcagcgccggccgcaattatgctgagcacaacgtggagtgacaaaggtgaaaacacaacgttcttttctttaaattcttctttggaga |
46543080 |
T |
 |
Q |
184 |
gcaaatggttggccatggtcatggaaaccttgattaggt |
222 |
Q |
|
|
|||||| ||||| ||||||| |||| |||| |||||| |
|
|
T |
46543079 |
acaaatgtttggcgatggtcacagaaaacttgtttaggt |
46543041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 118
Target Start/End: Complemental strand, 5155382 - 5155299
Alignment:
Q |
35 |
gttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgct |
118 |
Q |
|
|
||||||||| ||| ||||||| || ||||||||||||||||| ||| ||||||||||||||||||||||| || |||||||| |
|
|
T |
5155382 |
gttgagatggtcagtggatttggacaggaggaagtcgagaagctgttgttgtgtgggaccctcagagccagcagcgatgatgct |
5155299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 122
Target Start/End: Original strand, 4582480 - 4582585
Alignment:
Q |
17 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg |
116 |
Q |
|
|
||||||||| ||||||||||||||||||||| | ||||| ||| |||||||||||||||| || |||||| || ||||||||||| || || ||| |
|
|
T |
4582480 |
gagatgagaagcaaaggagttgagatgatcagttgatttggagagaaggaagtcgagaagctgttctcttgtgggtccgtcagagccagcagcgatcatg |
4582579 |
T |
 |
Q |
117 |
ctgagc |
122 |
Q |
|
|
|||||| |
|
|
T |
4582580 |
ctgagc |
4582585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 46531396 - 46531348
Alignment:
Q |
30 |
aaggagttgagatgatcaatggattttgagccgaggaagtcgagaagct |
78 |
Q |
|
|
||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
T |
46531396 |
aaggagttgagatgatcaatggattttgaaccaaggaaggagagaagct |
46531348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 103
Target Start/End: Original strand, 46507118 - 46507188
Alignment:
Q |
33 |
gagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagcc |
103 |
Q |
|
|
||||||||||||| || ||||| |||| ||||||||| |||| || ||| || ||||||||||||||||| |
|
|
T |
46507118 |
gagttgagatgatggatagatttggagcagaggaagtcaagaatctgttgttgagtgggaccctcagagcc |
46507188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 46469822 - 46469733
Alignment:
Q |
17 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagc |
106 |
Q |
|
|
||||||||| | |||||||||||||| || |||||||| || | |||||| |||||||| | ||| ||||| ||||||||||| |||| |
|
|
T |
46469822 |
gagatgagaagtgaaggagttgagatggtcgatggatttggaacggaggaattcgagaagttgttgttgtgtacgaccctcagaggcagc |
46469733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 9677618 - 9677722
Alignment:
Q |
17 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg |
116 |
Q |
|
|
|||||||||| | ||||||||||||||||| |||||||| | | ||||||||||||||||| ||| || || ||||||||||||||||| || ||||| |
|
|
T |
9677618 |
gagatgagagacgaaggagttgagatgatcgatggatttgaaacggaggaagtcgagaagctgttgttgagtaggaccctcagagccagcagcgatgata |
9677717 |
T |
 |
Q |
117 |
ctgag |
121 |
Q |
|
|
||||| |
|
|
T |
9677718 |
ctgag |
9677722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 222
Target Start/End: Original strand, 21465975 - 21466126
Alignment:
Q |
71 |
gagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagt |
170 |
Q |
|
|
|||||| | ||| ||||| ||||| ||||||||||| || |||||||| | ||| ||||| | | |||||||||||||||||||| ||||||| | |
|
|
T |
21465975 |
gagaagttgttgttgtgtcggaccttcagagccagcagcgatgatgctcaacacaatgtggagtgataatggcgaaaacacaacattggtttctttgtat |
21466074 |
T |
 |
Q |
171 |
tcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt |
222 |
Q |
|
|
||||||||||||| |||||| ||||| ||||||| ||||||||| |||||| |
|
|
T |
21466075 |
tcttgtttggagaacaaatgtttggcaatggtcaaagaaaccttggttaggt |
21466126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 9693359 - 9693463
Alignment:
Q |
17 |
gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg |
116 |
Q |
|
|
|||||||||| ||||| ||||||||||||| |||||||| | | ||||||||| ||||||| ||| || || ||||| ||||||||| | || |||||| |
|
|
T |
9693359 |
gagatgagagacaaagaagttgagatgatcgatggatttgaaacggaggaagtcaagaagctgttgttgagtaggaccgtcagagccaacagcgatgatg |
9693458 |
T |
 |
Q |
117 |
ctgag |
121 |
Q |
|
|
||||| |
|
|
T |
9693459 |
ctgag |
9693463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 32 - 121
Target Start/End: Complemental strand, 15555187 - 15555098
Alignment:
Q |
32 |
ggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgctgag |
121 |
Q |
|
|
||||||||| |||| |||||||| ||| ||||||||||||||| | ||| ||||||| ||||||||||||||| || ||||||||||| |
|
|
T |
15555187 |
ggagttgagttgatggatggatttaaagcggaggaagtcgagaagttgttgctgtgtggaaccctcagagccagcagcgatgatgctgag |
15555098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 124
Target Start/End: Complemental strand, 35160637 - 35160544
Alignment:
Q |
31 |
aggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgctgagcac |
124 |
Q |
|
|
||||||||||||||||| ||||||| | | ||||||||| ||||||| ||| ||||| | ||||||||||||||| | || ||||||||||| |
|
|
T |
35160637 |
aggagttgagatgatcagtggatttgaaacggaggaagtcaagaagctgttgttgtgttgaaccctcagagccagcagtgattatgctgagcac |
35160544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 16729416 - 16729332
Alignment:
Q |
138 |
aatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt |
222 |
Q |
|
|
||||| ||||||||||| ||||||||||| |||||||| ||||| | ||| || |||| ||| |||||||||| ||| |||||| |
|
|
T |
16729416 |
aatggtgaaaacacaacgttcttttctttgagttcttgattggataacaagtgtttggtgatgttcatggaaacgttggttaggt |
16729332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 17706488 - 17706404
Alignment:
Q |
138 |
aatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt |
222 |
Q |
|
|
||||| ||||||||||| ||||||||||| |||||||| ||||| | ||| || |||| ||| |||||||||| ||| |||||| |
|
|
T |
17706488 |
aatggtgaaaacacaacgttcttttctttgagttcttgattggataacaagtgtttggtgatgttcatggaaacgttggttaggt |
17706404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 17716476 - 17716392
Alignment:
Q |
138 |
aatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt |
222 |
Q |
|
|
||||| ||||||||||||||||||||||| |||| ||| ||||| | ||| || |||| ||| |||||||||| ||| |||||| |
|
|
T |
17716476 |
aatggtgaaaacacaacattcttttctttgagtttttgattggataacaagtgtttggtgatgttcatggaaacgttggttaggt |
17716392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 106
Target Start/End: Complemental strand, 20154511 - 20154467
Alignment:
Q |
62 |
gaggaagtcgagaagcttttgatgtgtgggaccctcagagccagc |
106 |
Q |
|
|
||||||||||| ||||| ||| ||||||||||| ||||||||||| |
|
|
T |
20154511 |
gaggaagtcgacaagctgttgttgtgtgggaccttcagagccagc |
20154467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 245 times since January 2019
Visitors: 3262