View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440_2D_low_36 (Length: 237)

Name: NF0440_2D_low_36
Description: NF0440_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440_2D_low_36
NF0440_2D_low_36
[»] chr3 (8 HSPs)
chr3 (17-235)||(47414940-47415158)
chr3 (17-223)||(47398296-47398502)
chr3 (84-222)||(46543041-46543179)
chr3 (35-118)||(5155299-5155382)
chr3 (17-122)||(4582480-4582585)
chr3 (30-78)||(46531348-46531396)
chr3 (33-103)||(46507118-46507188)
chr3 (17-106)||(46469733-46469822)
[»] chr8 (3 HSPs)
chr8 (17-121)||(9677618-9677722)
chr8 (71-222)||(21465975-21466126)
chr8 (17-121)||(9693359-9693463)
[»] chr4 (2 HSPs)
chr4 (32-121)||(15555098-15555187)
chr4 (31-124)||(35160544-35160637)
[»] chr7 (3 HSPs)
chr7 (138-222)||(16729332-16729416)
chr7 (138-222)||(17706404-17706488)
chr7 (138-222)||(17716392-17716476)
[»] chr2 (1 HSPs)
chr2 (62-106)||(20154467-20154511)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 8)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 235
Target Start/End: Original strand, 47414940 - 47415158
Alignment:
Q  17 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  47414940 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtggtaccctcagagccagccgcaatgatg 47415039  T
Q  117 ctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttga 216  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47415040 atgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttga 47415139  T
Q  217 ttaggtcatggttcatatc 235  Q
    |||||||||||||||||||    
T  47415140 ttaggtcatggttcatatc 47415158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 17 - 223
Target Start/End: Original strand, 47398296 - 47398502
Alignment:
Q  17 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg 116  Q
    |||||||||||| |||||||||||||| ||| |||| || || || |||||||||||||||| ||| ||||||||||||||||||||||| ||  |||||    
T  47398296 gagatgagaggcgaaggagttgagatgttcagtggacttggacccaaggaagtcgagaagctcttgttgtgtgggaccctcagagccagcagcgttgatg 47398395  T
Q  117 ctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttga 216  Q
    || ||||||| ||| |    ||| ||||||||||||||||||||||||||||  | ||||||||||| ||||||| |||||||||||||||||||||||     
T  47398396 cttagcacggtgtgtagcgtcaaaggcgaaaacacaacattcttttctttaaaattttgtttggagaacaaatggctggccatggtcatggaaaccttgg 47398495  T
Q  217 ttaggtc 223  Q
    |||||||    
T  47398496 ttaggtc 47398502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 84 - 222
Target Start/End: Complemental strand, 46543179 - 46543041
Alignment:
Q  84 tgtgtgggaccctcagagccagccgcaatgatgctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagttcttgtttggaga 183  Q
    |||||||||||||||| ||| |||||||| |||||||||||   ||||| | |||| || ||||||||||| ||||||||||||| ||||| ||||||||    
T  46543179 tgtgtgggaccctcagcgccggccgcaattatgctgagcacaacgtggagtgacaaaggtgaaaacacaacgttcttttctttaaattcttctttggaga 46543080  T
Q  184 gcaaatggttggccatggtcatggaaaccttgattaggt 222  Q
     |||||| ||||| |||||||  |||| |||| ||||||    
T  46543079 acaaatgtttggcgatggtcacagaaaacttgtttaggt 46543041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 118
Target Start/End: Complemental strand, 5155382 - 5155299
Alignment:
Q  35 gttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgct 118  Q
    ||||||||| ||| ||||||| ||   ||||||||||||||||| ||| ||||||||||||||||||||||| || ||||||||    
T  5155382 gttgagatggtcagtggatttggacaggaggaagtcgagaagctgttgttgtgtgggaccctcagagccagcagcgatgatgct 5155299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 122
Target Start/End: Original strand, 4582480 - 4582585
Alignment:
Q  17 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg 116  Q
    ||||||||| ||||||||||||||||||||| | ||||| |||   |||||||||||||||| ||    |||||| || ||||||||||| || || |||    
T  4582480 gagatgagaagcaaaggagttgagatgatcagttgatttggagagaaggaagtcgagaagctgttctcttgtgggtccgtcagagccagcagcgatcatg 4582579  T
Q  117 ctgagc 122  Q
    ||||||    
T  4582580 ctgagc 4582585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 46531396 - 46531348
Alignment:
Q  30 aaggagttgagatgatcaatggattttgagccgaggaagtcgagaagct 78  Q
    ||||||||||||||||||||||||||||| || ||||||  ||||||||    
T  46531396 aaggagttgagatgatcaatggattttgaaccaaggaaggagagaagct 46531348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 103
Target Start/End: Original strand, 46507118 - 46507188
Alignment:
Q  33 gagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagcc 103  Q
    |||||||||||||  || ||||| |||| ||||||||| |||| || ||| || |||||||||||||||||    
T  46507118 gagttgagatgatggatagatttggagcagaggaagtcaagaatctgttgttgagtgggaccctcagagcc 46507188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 106
Target Start/End: Complemental strand, 46469822 - 46469733
Alignment:
Q  17 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagc 106  Q
    ||||||||| |  |||||||||||||| || |||||||| || | |||||| |||||||| | ||| |||||  ||||||||||| ||||    
T  46469822 gagatgagaagtgaaggagttgagatggtcgatggatttggaacggaggaattcgagaagttgttgttgtgtacgaccctcagaggcagc 46469733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 9677618 - 9677722
Alignment:
Q  17 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg 116  Q
    |||||||||| | ||||||||||||||||| ||||||||  | | ||||||||||||||||| ||| || || ||||||||||||||||| || |||||     
T  9677618 gagatgagagacgaaggagttgagatgatcgatggatttgaaacggaggaagtcgagaagctgttgttgagtaggaccctcagagccagcagcgatgata 9677717  T
Q  117 ctgag 121  Q
    |||||    
T  9677718 ctgag 9677722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 71 - 222
Target Start/End: Original strand, 21465975 - 21466126
Alignment:
Q  71 gagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgctgagcacggagtggattaacaatggcgaaaacacaacattcttttctttaagt 170  Q
    |||||| | ||| ||||| ||||| ||||||||||| || |||||||| | |||   ||||| | | ||||||||||||||||||||  |||||||   |    
T  21465975 gagaagttgttgttgtgtcggaccttcagagccagcagcgatgatgctcaacacaatgtggagtgataatggcgaaaacacaacattggtttctttgtat 21466074  T
Q  171 tcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt 222  Q
    ||||||||||||| |||||| ||||| |||||||  ||||||||| ||||||    
T  21466075 tcttgtttggagaacaaatgtttggcaatggtcaaagaaaccttggttaggt 21466126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 9693359 - 9693463
Alignment:
Q  17 gagatgagaggcaaaggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatg 116  Q
    |||||||||| ||||| ||||||||||||| ||||||||  | | ||||||||| ||||||| ||| || || ||||| ||||||||| | || ||||||    
T  9693359 gagatgagagacaaagaagttgagatgatcgatggatttgaaacggaggaagtcaagaagctgttgttgagtaggaccgtcagagccaacagcgatgatg 9693458  T
Q  117 ctgag 121  Q
    |||||    
T  9693459 ctgag 9693463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 32 - 121
Target Start/End: Complemental strand, 15555187 - 15555098
Alignment:
Q  32 ggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgctgag 121  Q
    ||||||||| ||||  ||||||||  ||| ||||||||||||||| | ||| ||||||| ||||||||||||||| || |||||||||||    
T  15555187 ggagttgagttgatggatggatttaaagcggaggaagtcgagaagttgttgctgtgtggaaccctcagagccagcagcgatgatgctgag 15555098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 124
Target Start/End: Complemental strand, 35160637 - 35160544
Alignment:
Q  31 aggagttgagatgatcaatggattttgagccgaggaagtcgagaagcttttgatgtgtgggaccctcagagccagccgcaatgatgctgagcac 124  Q
    ||||||||||||||||| |||||||  | | ||||||||| ||||||| ||| ||||| | ||||||||||||||| |  || |||||||||||    
T  35160637 aggagttgagatgatcagtggatttgaaacggaggaagtcaagaagctgttgttgtgttgaaccctcagagccagcagtgattatgctgagcac 35160544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 16729416 - 16729332
Alignment:
Q  138 aatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt 222  Q
    ||||| ||||||||||| ||||||||||| |||||||| ||||| | ||| || ||||  ||| |||||||||| ||| ||||||    
T  16729416 aatggtgaaaacacaacgttcttttctttgagttcttgattggataacaagtgtttggtgatgttcatggaaacgttggttaggt 16729332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 17706488 - 17706404
Alignment:
Q  138 aatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt 222  Q
    ||||| ||||||||||| ||||||||||| |||||||| ||||| | ||| || ||||  ||| |||||||||| ||| ||||||    
T  17706488 aatggtgaaaacacaacgttcttttctttgagttcttgattggataacaagtgtttggtgatgttcatggaaacgttggttaggt 17706404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 17716476 - 17716392
Alignment:
Q  138 aatggcgaaaacacaacattcttttctttaagttcttgtttggagagcaaatggttggccatggtcatggaaaccttgattaggt 222  Q
    ||||| ||||||||||||||||||||||| |||| ||| ||||| | ||| || ||||  ||| |||||||||| ||| ||||||    
T  17716476 aatggtgaaaacacaacattcttttctttgagtttttgattggataacaagtgtttggtgatgttcatggaaacgttggttaggt 17716392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 106
Target Start/End: Complemental strand, 20154511 - 20154467
Alignment:
Q  62 gaggaagtcgagaagcttttgatgtgtgggaccctcagagccagc 106  Q
    ||||||||||| ||||| ||| ||||||||||| |||||||||||    
T  20154511 gaggaagtcgacaagctgttgttgtgtgggaccttcagagccagc 20154467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 245 times since January 2019
Visitors: 3262