View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0440_high_4 (Length: 258)

Name: NF0440_high_4
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0440_high_4
NF0440_high_4
[»] chr2 (1 HSPs)
chr2 (30-253)||(40207957-40208180)
[»] chr4 (2 HSPs)
chr4 (90-182)||(21793213-21793305)
chr4 (99-139)||(4483487-4483527)
[»] chr3 (1 HSPs)
chr3 (111-177)||(31460746-31460812)
[»] chr5 (2 HSPs)
chr5 (111-142)||(2650119-2650150)
chr5 (201-237)||(2622039-2622075)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 30 - 253
Target Start/End: Complemental strand, 40208180 - 40207957
Alignment:
30 gttttgaccattattggttatagtagacaaagtgatacctctatcaaaggtaacacagaatgtgatggtgttggtgttttgggaattgcttgggcttttg 129  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40208180 gttttgaccattattggttatagtagacaaagtgataccactatcaaaggtaacacagaatgtgatggtgttggtgttttgggaattgcttgggcttttg 40208081  T
130 gtggtatgatcttcatccttgtttactgcaccgccggtatctctggtaagctaccgttctcacttgatttcgttgaatgttgtttaaggtagttacaagt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40208080 gtggtatgatcttcatccttgtttactgcaccgccggtatctctggtaagctaccgttctcacttgatttcgttgaatgttgtttaaggtagttacaagt 40207981  T
230 tagttatttagtcggaaagtgtat 253  Q
    ||||||||||||||||||||||||    
40207980 tagttatttagtcggaaagtgtat 40207957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 90 - 182
Target Start/End: Original strand, 21793213 - 21793305
Alignment:
90 tgtgatggtgttggtgttttgggaattgcttgggcttttggtggtatgatcttcatccttgtttactgcaccgccggtatctctggtaagcta 182  Q
    ||||||||||||||  ||||||| |||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| ||||    
21793213 tgtgatggtgttggaattttgggtattgcttgggcttttggtggcatgattttcattcttgtttactgcaccgccggtatctctggtatgcta 21793305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 139
Target Start/End: Complemental strand, 4483527 - 4483487
Alignment:
99 gttggtgttttgggaattgcttgggcttttggtggtatgat 139  Q
    |||||||||  |||||||||||||||||||||||| |||||    
4483527 gttggtgttcagggaattgcttgggcttttggtggaatgat 4483487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 31460812 - 31460746
Alignment:
111 ggaattgcttgggcttttggtggtatgatcttcatccttgtttactgcaccgccggtatctctggta 177  Q
    |||||||||||| |||||||||| ||||||||    ||||||||||| ||||| |||||||||||||    
31460812 ggaattgcttggtcttttggtggcatgatctttgctcttgtttactgtaccgctggtatctctggta 31460746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 111 - 142
Target Start/End: Complemental strand, 2650150 - 2650119
Alignment:
111 ggaattgcttgggcttttggtggtatgatctt 142  Q
    ||||||||||||||||||||||||||||||||    
2650150 ggaattgcttgggcttttggtggtatgatctt 2650119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 201 - 237
Target Start/End: Original strand, 2622039 - 2622075
Alignment:
201 gttgaatgttgtttaaggtagttacaagttagttatt 237  Q
    ||||||| ||||||||||||||||| |||||||||||    
2622039 gttgaatattgtttaaggtagttacgagttagttatt 2622075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University