View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_low_3 (Length: 322)
Name: NF0440_low_3
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 30 - 180
Target Start/End: Complemental strand, 50968682 - 50968532
Alignment:
Q |
30 |
aattcaactatatacaagcgatccaattgtagagcagggtgtgattgatgttttaattttgggatgaagggacatgttagacaaccagggtgtaagttgt |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
50968682 |
aattcaactatatacaagcgatccaattgtagagcagggtgtgattgatgttttaattttgggatgaagggacatgttagacgaccagggtgtaagttgt |
50968583 |
T |
 |
Q |
130 |
aacaattcagtttgctttagttgtttgttttaaaatacaattgtctcacaa |
180 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50968582 |
aacaattcagtttgctttagttgtttgttttaaaatacaattgtctcacaa |
50968532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 249 - 296
Target Start/End: Complemental strand, 50968463 - 50968416
Alignment:
Q |
249 |
gtatagctaactgtactcaaatatttcatacatccatgttcatccatc |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50968463 |
gtatagctaactgtactcaaatatttcatacatccatgttcatccatc |
50968416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University