View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0440_low_6 (Length: 205)
Name: NF0440_low_6
Description: NF0440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0440_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 45459028 - 45458855
Alignment:
Q |
1 |
acttgacgaaaaatcagaaggataaaatacatcagaatacttgaatcactgcctattactttcgctctaaaggtgaactcaaaggtggttgatcaacatt |
100 |
Q |
|
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45459028 |
acttgacaaaaaatcagaaggataaaatgcatcagaatacttgaatcactgcctattactttcgctctaaaggtgaactcaaaggtggttgatcaacacc |
45458929 |
T |
 |
Q |
101 |
actgcctacaaatatcattgctattttatcattttatgagtgggtatagtagagcatgtttattaggaatgtcaac |
176 |
Q |
|
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
T |
45458928 |
acttcctacaaatatcattgctattttatcattttatgagtggg--tagtagagcatgtttattaggagtgtcaac |
45458855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University