View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0441_low_14 (Length: 204)
Name: NF0441_low_14
Description: NF0441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0441_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 4795608 - 4795558
Alignment:
| Q |
1 |
gtcgcaggcggcgacacgtcattcctttcacaatcaaccatgagtcgcggc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4795608 |
gtcgcaggcggcgacacgtcattcctttcacaattaaccatgagtcgcggc |
4795558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University