View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0441_low_9 (Length: 246)
Name: NF0441_low_9
Description: NF0441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0441_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 19618829 - 19618985
Alignment:
| Q |
1 |
ttaaaacaacaatcaattgtggaaagcatttctaattatctcttaggtccaatttgaagaatctactatctacctttagatcaacagccgacgttgtcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19618829 |
ttaaaacaacaatcaattgtggaaagcatttctaatcatctcttaagtcaaacttgaagaatctactatctacctttagatcaacagccgacgttgtcgt |
19618928 |
T |
|
| Q |
101 |
agcaggccagagaacgacggcggctgttcagaagagttgtgtacttgcaaatatttc |
157 |
Q |
| |
|
||||||| ||||||||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
19618929 |
agcaggctagagaacgacgacggctgtttagaagagtagtgtacttgcaaatatttc |
19618985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University