View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_high_11 (Length: 213)
Name: NF0442_high_11
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0442_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 23118773 - 23118853
Alignment:
| Q |
1 |
agacaacttagtaacctgttgggttgtgaaagggtgtgatgttaagctcttaagcacatcactggcttcttgagcagaaaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23118773 |
agacaacttagtaacctgttgggttgtgaaagggtgtgatgtgaagctcttaagcacatcactggctttttgagcagaaaa |
23118853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University