View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_high_5 (Length: 282)
Name: NF0442_high_5
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0442_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 223
Target Start/End: Original strand, 1445432 - 1445627
Alignment:
Q |
28 |
atttaaaacctgtaattttcagtgcagtatatcatcacagttaacagtaatcgaaattgcaatttaattttttcttaatttgtagtgcactgcgacaaag |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1445432 |
atttaaaacctgtaattttcagtgcagtatatcatcacagttaacagtaatcgaaattgcaatttaattttttcttaatttgtagtgcactgcgacaaag |
1445531 |
T |
 |
Q |
128 |
tttacaatgactttcatagcgagacatagttcatcaaaccaccaaatccagcaatgtctttgtaacagactagcagctaatgaaacaaaagagaga |
223 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1445532 |
tttacaatgactttcatagcgacacatagttcatcaaaccaccaaatccagcaatgtctttgtaacagactagcagctaatgaaacaaaagagaga |
1445627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 247 - 282
Target Start/End: Original strand, 1445647 - 1445682
Alignment:
Q |
247 |
gttatcatacatattccgaataaaatgaaaatttac |
282 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
1445647 |
gttatcatacatattccgaataaaatgaaaatttac |
1445682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 179 - 223
Target Start/End: Original strand, 18211392 - 18211436
Alignment:
Q |
179 |
caatgtctttgtaacagactagcagctaatgaaacaaaagagaga |
223 |
Q |
|
|
||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
T |
18211392 |
caatgtcttggtagcagactagcagctaatgaaacaaaagagaga |
18211436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 179 - 223
Target Start/End: Complemental strand, 37897384 - 37897340
Alignment:
Q |
179 |
caatgtctttgtaacagactagcagctaatgaaacaaaagagaga |
223 |
Q |
|
|
||||||||| ||| ||||||||||||||||||||| ||||||||| |
|
|
T |
37897384 |
caatgtcttggtagcagactagcagctaatgaaaccaaagagaga |
37897340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University