View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0442_high_6 (Length: 281)

Name: NF0442_high_6
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0442_high_6
NF0442_high_6
[»] chr6 (1 HSPs)
chr6 (179-275)||(23118757-23118853)
[»] chr1 (2 HSPs)
chr1 (64-147)||(46894561-46894644)
chr1 (8-66)||(46894440-46894498)


Alignment Details
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 179 - 275
Target Start/End: Original strand, 23118757 - 23118853
Alignment:
Q  179 gtgagatgaatagatgagacaacttagtaacctgttgggttgtgaaagggtgtgatgttaagctcttaagcacatcactggcttcttgagcagaaaa 275  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||    
T  23118757 gtgagatgaatagatgagacaacttagtaacctgttgggttgtgaaagggtgtgatgtgaagctcttaagcacatcactggctttttgagcagaaaa 23118853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 64 - 147
Target Start/End: Original strand, 46894561 - 46894644
Alignment:
Q  64 tttcatttttcagaatcaaattaacacatcaagaaaaacaaataacaactcttgtagcaccaacacttctcaacttgtctgatg 147  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  46894561 tttcatttttcagaatcaaattaacagatcaagaaaaacaaataacaacttttgtagcaccaacacttctcaacttgtctgatg 46894644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 46894440 - 46894498
Alignment:
Q  8 gtttgactattgttcttaccaaatcactttttgaaacatttcaataaacaaaatatttt 66  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  46894440 gtttgactattgttcttaccaaatcactttttgaaacatttcaataaacataatatttt 46894498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University