View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_high_8 (Length: 255)
Name: NF0442_high_8
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0442_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 3 - 159
Target Start/End: Complemental strand, 11869453 - 11869297
Alignment:
Q |
3 |
attgcttgccgcaactaacgatgaacagtcggtgtaatgtacctgactggccctgtcatattcagcttcacttctagaagcatcctcaatttggaagggt |
102 |
Q |
|
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11869453 |
attgcttgccgcaactaaggatgaacagttggtgtaatgtacctgactggccctgtcatattcagcttcacttctagaagcatcctcaatttggaagggt |
11869354 |
T |
 |
Q |
103 |
aaaacgggatcagccctactcacaaaatacaatttacttgactttccacctataacg |
159 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11869353 |
aaaacgggatcagccctactcacaaaatacaatttacttgactttccacctataacg |
11869297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University