View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0442_high_8 (Length: 255)

Name: NF0442_high_8
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0442_high_8
NF0442_high_8
[»] chr5 (1 HSPs)
chr5 (3-159)||(11869297-11869453)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 3 - 159
Target Start/End: Complemental strand, 11869453 - 11869297
Alignment:
3 attgcttgccgcaactaacgatgaacagtcggtgtaatgtacctgactggccctgtcatattcagcttcacttctagaagcatcctcaatttggaagggt 102  Q
    |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11869453 attgcttgccgcaactaaggatgaacagttggtgtaatgtacctgactggccctgtcatattcagcttcacttctagaagcatcctcaatttggaagggt 11869354  T
103 aaaacgggatcagccctactcacaaaatacaatttacttgactttccacctataacg 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11869353 aaaacgggatcagccctactcacaaaatacaatttacttgactttccacctataacg 11869297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University