View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_low_10 (Length: 281)
Name: NF0442_low_10
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0442_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 179 - 275
Target Start/End: Original strand, 23118757 - 23118853
Alignment:
| Q |
179 |
gtgagatgaatagatgagacaacttagtaacctgttgggttgtgaaagggtgtgatgttaagctcttaagcacatcactggcttcttgagcagaaaa |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23118757 |
gtgagatgaatagatgagacaacttagtaacctgttgggttgtgaaagggtgtgatgtgaagctcttaagcacatcactggctttttgagcagaaaa |
23118853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 64 - 147
Target Start/End: Original strand, 46894561 - 46894644
Alignment:
| Q |
64 |
tttcatttttcagaatcaaattaacacatcaagaaaaacaaataacaactcttgtagcaccaacacttctcaacttgtctgatg |
147 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46894561 |
tttcatttttcagaatcaaattaacagatcaagaaaaacaaataacaacttttgtagcaccaacacttctcaacttgtctgatg |
46894644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 46894440 - 46894498
Alignment:
| Q |
8 |
gtttgactattgttcttaccaaatcactttttgaaacatttcaataaacaaaatatttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46894440 |
gtttgactattgttcttaccaaatcactttttgaaacatttcaataaacataatatttt |
46894498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University