View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_low_11 (Length: 280)
Name: NF0442_low_11
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0442_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 46894457 - 46894317
Alignment:
| Q |
1 |
taagaacaatagtcaaacnnnnnnncaatatgatccttataaattcgttgagtttattatgtttctttagattattatagtgccatataaaaaataagct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894457 |
taagaacaatagtcaaacaaaaaaacaatatgatccttataaattcgttgagtttattatgtttctttagattattatagtgccatataaaaaataagct |
46894358 |
T |
 |
| Q |
101 |
tgttctggattgtaggcaacatgaatcctagaggcaatacg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894357 |
tgttctggattgtaggcaacatgaatcctagaggcaatacg |
46894317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 178 - 274
Target Start/End: Original strand, 23118757 - 23118853
Alignment:
| Q |
178 |
gtgagatgaatagatgagacaacttagtaacctgttgggttgtgaaagggtgtgatgttaagctcttaagcacatcactggcttcttgagcagaaaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23118757 |
gtgagatgaatagatgagacaacttagtaacctgttgggttgtgaaagggtgtgatgtgaagctcttaagcacatcactggctttttgagcagaaaa |
23118853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University