View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_low_12 (Length: 265)
Name: NF0442_low_12
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0442_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 109 - 176
Target Start/End: Complemental strand, 25643930 - 25643863
Alignment:
| Q |
109 |
ctgttaattaatgcaggcaaagaaggcgaaagaggataaggaagtgacaaacaaggtttactttgatg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25643930 |
ctgttaattaatgcaggcaaagaaggcgaaagaggataaggaagtgacaaacaaggtttactttgatg |
25643863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 25644038 - 25643993
Alignment:
| Q |
1 |
tcatttagattaagatcgatacttaattattctatattatgattag |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25644038 |
tcatttagattaagatcgatacttaattatgatatattatgattag |
25643993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University