View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_low_19 (Length: 205)
Name: NF0442_low_19
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0442_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 43868406 - 43868526
Alignment:
| Q |
1 |
gacaagtgtttgattataaacaagagaatgaaatggatgcatccaaaaatgaaatgttaaaggttaaggatgaagaacttgatgatttggaatcagtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43868406 |
gacaagtgtttgattataaacaagagaatgaaatggatgcatccaaaagtgaaatgttaaaggttaaggatgaagaacttgatgatttggaatcagtttt |
43868505 |
T |
|
| Q |
101 |
tgacatgacaagtgatgatgt |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43868506 |
tgacatgacaagtgatgatgt |
43868526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University