View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0442_low_21 (Length: 202)

Name: NF0442_low_21
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0442_low_21
NF0442_low_21
[»] chr4 (1 HSPs)
chr4 (1-107)||(54032514-54032620)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 54032620 - 54032514
Alignment:
1 tgtccattgatgaataataatcttgtcacctaaaagattattaattctggttttattaattttttacctgcatgatcatccaacatgaccaaaaaacact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54032620 tgtccattgatgaataataatcttgtcacctaaaagattattaattctggttttattaattttttacctgcatgatcatccaacatgaccaaaaaacact 54032521  T
101 acttgct 107  Q
    |||||||    
54032520 acttgct 54032514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University