View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_low_7 (Length: 291)
Name: NF0442_low_7
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0442_low_7 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 59 - 291
Target Start/End: Original strand, 49520161 - 49520393
Alignment:
| Q |
59 |
catcatcacagtataatttccaattcctctcagcaacgcggttcaaaagttttacacattccagcctttcaggctcgtcaaaatcatcgctgttatctcc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520161 |
catcatcacagtataatttccaattcctctcagcaacgcggttcaaaagttttacacattccagcctttcaggctcgtcaaaatcatcgctgttatctcc |
49520260 |
T |
|
| Q |
159 |
aatgtgttcataccataatgctctcctgaagccatacacctgaccttgtggtctttgtgagccattggatgtggatgctagatgatgaggttgaaatgca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49520261 |
aatgtgttcataccataatgctctcctgaagccatatacctgaccttgtggtctttgtgagccattggatgtggatgctagatgatgaggttgaaatgca |
49520360 |
T |
|
| Q |
259 |
cccattgcaatctctgtgtctcttccaccatcc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49520361 |
cccattgcaatctctgtgtctcttccaccatcc |
49520393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 247 - 291
Target Start/End: Original strand, 49509077 - 49509121
Alignment:
| Q |
247 |
ggttgaaatgcacccattgcaatctctgtgtctcttccaccatcc |
291 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
49509077 |
ggttgaaatgcacctattgcaatctcactgtctcttgcaccatcc |
49509121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University