View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0442_low_8 (Length: 283)
Name: NF0442_low_8
Description: NF0442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0442_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 118 - 214
Target Start/End: Complemental strand, 23118853 - 23118757
Alignment:
Q |
118 |
ttttctgctcaagaagacagtgatgtgcttaagagcttaacagcacaccctttcacaacccaacaggttactaagttgtatcatctattcatctcac |
214 |
Q |
|
|
|||||||||||| ||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
23118853 |
ttttctgctcaaaaagccagtgatgtgcttaagagcttcacatcacaccctttcacaacccaacaggttactaagttgtctcatctattcatctcac |
23118757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University