View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0443_high_13 (Length: 251)
Name: NF0443_high_13
Description: NF0443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0443_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 38072892 - 38072652
Alignment:
| Q |
1 |
aaggaatggcgatcgaccctatttgtctctgttgtggaaatgttaaggagtacttgaatcatgtctttaaagattgctcttgggttaaaatatgtggttt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072892 |
aaggaatggcgattgaccctatttgtctctgttgtggaaatgttaaggagtacttgaatcatgtctttaaagattgctcttgggttaaaatatgtggttt |
38072793 |
T |
|
| Q |
101 |
cattctcctttgggtacgtgttcggtcaaagagtcctccattcctttcataccttggctagctagaacaagttattttccactcatctcaagatattatt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38072792 |
cattctcctttgg-tacgtgttcggtcaaagagtcctccattcctttcataccttggctagctagaacaagttattttccactcatctcaagatattatt |
38072694 |
T |
|
| Q |
201 |
tcatatgtgttgtacctttgttatatcattttccattcatct |
242 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38072693 |
tcatatgtgttgtacctttgttatgtcattttccattcatct |
38072652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 261 times since January 2019
Visitors: 3262