View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0443_high_14 (Length: 250)
Name: NF0443_high_14
Description: NF0443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0443_high_14 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 29 - 250
Target Start/End: Complemental strand, 4884387 - 4884166
Alignment:
Q |
29 |
agttcttttgtataattttgagggtttgttcatcactagtgttttggttttggttcaaataaggcaagaaatatgtaaaggtttgaatttatttattttg |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4884387 |
agttcttttgtataattttgagggtttgttcatcactagtgttttggttttggttcaaataaggcaagaaatatgtaaaggtttgaatttatttattttg |
4884288 |
T |
 |
Q |
129 |
gtttttaatggatgatgaagcttaaaagttgaagtgcacatggaaagataaaaactattgagagaagagatcaaatgattggaatacaggagaaaagnnn |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4884287 |
gtttttaatggatgatgaagcttaaaagttgaagtgcacatggaaagataaaaactattgagagaagagatcaaatgattggaatacaggagaaaagaaa |
4884188 |
T |
 |
Q |
229 |
nnnnggatgccattactattgt |
250 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
4884187 |
aaaaggatgccattactattgt |
4884166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 224 times since January 2019
Visitors: 3261