View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0443_high_17 (Length: 213)
Name: NF0443_high_17
Description: NF0443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0443_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 45383355 - 45383291
Alignment:
| Q |
9 |
ttagtgtttgcatatacaacacccctgccaaagagctcagccatcgtcctcagttgcgtttcatc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383355 |
ttagtgtttgcatatacaacacccctgccaaagagctcagccatcgtcctcagttgcgtttcatc |
45383291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 103 times since January 2019
Visitors: 3247