View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0443_high_5 (Length: 395)
Name: NF0443_high_5
Description: NF0443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0443_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 30 - 385
Target Start/End: Complemental strand, 38073213 - 38072862
Alignment:
| Q |
30 |
gttcatatatcattctcttattcatcacaagcatcgctgataactacaactttcttgatttttgaagtcatgcaaatccttcaacttccattgctaaccg |
129 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38073213 |
gttcatatataattctcttattcatcacaagcatcgccgataactacaactttcttgatttttgaagtcatgcaaatccttcaacttccattgctaaccg |
38073114 |
T |
|
| Q |
130 |
cacatcaaatggattgtctaatatggagtcctcataagaaaagtatgttttggatcaagattgcttatcattaattctattaggtattgagaggaatcca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38073113 |
cacatcaaatggattgtctaatatggagtcctcataagaaaagtatgttttggatcaagattgcttatcattaattctattaggtattgagaggaatcca |
38073014 |
T |
|
| Q |
230 |
atccctatcatgtttctgtttataataccaactctcagtgttggtcgaagctttaacacatgtaaatcttgtttggagaatttttctttttaattagtct |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
38073013 |
atccctatcatgtttctgtttataataccaactctcagtgttggtcgaagctttaacacatgtaaatcttgtttggagtatttttcttt----ttagtct |
38072918 |
T |
|
| Q |
330 |
tcttaccaaaaagaagtttttaataaaggaatggcgatcgaccctatttgtctctg |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38072917 |
tcttaccaaaaagaagtttttaataaaggaatggcgattgaccctatttgtctctg |
38072862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1574 times since January 2019
Visitors: 3232