View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0443_low_11 (Length: 349)
Name: NF0443_low_11
Description: NF0443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0443_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 87 - 251
Target Start/End: Complemental strand, 34060095 - 34059934
Alignment:
| Q |
87 |
acagatcaaaattgccttgaaacttaactctcaatctctgaattgaatcaactgttttctgtgatgattggttgattttatcgaagtctgtcnnnnnnnn |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34060095 |
acagatcaaaattgccttgaaacttaactctcaatctctgaattgaatcaactgttttctgtgatgattggttgattttatcgaagtatgt---aaaaaa |
34059999 |
T |
|
| Q |
187 |
nncagctatactaggaagcatgcactgttgtactgctcttttagagttggaaactatgaacgcga |
251 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059998 |
aacagctatactaggtagcatgcactgttgtactgctcttttagagttggaaactatgaacgcga |
34059934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 91 - 247
Target Start/End: Original strand, 22232170 - 22232332
Alignment:
| Q |
91 |
atcaaaattgccttgaaacttaactctcaatctctgaattgaatcaactgttttctg---------tgatgattggttgattttatcgaagtctgtcnnn |
181 |
Q |
| |
|
||||| || |||||||||||| |||||||||||||||||||||| || |||| ||| |||||||||||||||||||||||||| ||| |
|
|
| T |
22232170 |
atcaacatagccttgaaacttgtctctcaatctctgaattgaatctaccgtttgctgcagattttgtgatgattggttgattttatcgaagtgtgtgaga |
22232269 |
T |
|
| Q |
182 |
nnnnnnncagctatactaggaagcatgcactgttgtactgctcttttagagttggaaactatgaac |
247 |
Q |
| |
|
||||| ||| || |||||||| |||||| |||||||||| || ||||||||||||||| |
|
|
| T |
22232270 |
acaat---agctacacttggcagcatgcattgttgtcctgctcttttggaattggaaactatgaac |
22232332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 104 times since January 2019
Visitors: 3248