View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0443_low_8 (Length: 350)
Name: NF0443_low_8
Description: NF0443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0443_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 89 - 252
Target Start/End: Complemental strand, 34060093 - 34059934
Alignment:
Q |
89 |
agatcaaaattgccttgaaacttaactctcaatctctgaattgaatcaactgttttctgtgatgattggttgattttatcgaagtctgtcnnnnnnnnnn |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
34060093 |
agatcaaaattgccttgaaacttaactctcaatctctgaattgaatcaactgttttctgtgatgattggttgattttatcgaagtatgt----aaaaaaa |
34059998 |
T |
 |
Q |
189 |
ncagctatactaggaagcatgcactgttgtactgctcttttagagttggaaactatgaacgcga |
252 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34059997 |
acagctatactaggtagcatgcactgttgtactgctcttttagagttggaaactatgaacgcga |
34059934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 91 - 173
Target Start/End: Original strand, 22232170 - 22232261
Alignment:
Q |
91 |
atcaaaattgccttgaaacttaactctcaatctctgaattgaatcaactgtt---------ttctgtgatgattggttgattttatcgaagt |
173 |
Q |
|
|
||||| || |||||||||||| |||||||||||||||||||||| || ||| || |||||||||||||||||||||||||||| |
|
|
T |
22232170 |
atcaacatagccttgaaacttgtctctcaatctctgaattgaatctaccgtttgctgcagattttgtgatgattggttgattttatcgaagt |
22232261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 191 - 248
Target Start/End: Original strand, 22232275 - 22232332
Alignment:
Q |
191 |
agctatactaggaagcatgcactgttgtactgctcttttagagttggaaactatgaac |
248 |
Q |
|
|
||||| ||| || |||||||| |||||| |||||||||| || ||||||||||||||| |
|
|
T |
22232275 |
agctacacttggcagcatgcattgttgtcctgctcttttggaattggaaactatgaac |
22232332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University