View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0444_high_10 (Length: 267)
Name: NF0444_high_10
Description: NF0444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0444_high_10 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 24 - 257
Target Start/End: Complemental strand, 9292 - 9059
Alignment:
| Q |
24 |
ttaatcaacatttataagcagttagttgtatgtgacagcaataccattagtgttgtcaattgtggattgcgaagaaatagcgttttgtgcaaattccact |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9292 |
ttaatcaacatttataagcagttagttgtatgtgacagcaataccattagtgttgtcaattgcggattgcgaagaaatagcgttttgtgcaaattccact |
9193 |
T |
|
| Q |
124 |
atactatagttctatagccgctatatgacgaaaatttgtactaaatagttcatcgcctaacaatgacgatttattcaaattccacttaccttcaccttgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9192 |
atactatagttctatagccgctatatgacgaaaatttgtactaaatagttcatcgcctaacaatgacgatttattcaaattccacttaccttcaccttgt |
9093 |
T |
|
| Q |
224 |
ctaggtacaactcaggcgcaattatctttctctg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9092 |
ctaggtacaactcaggcgcaattatctttctctg |
9059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 19206966 - 19206905
Alignment:
| Q |
24 |
ttaatcaacatttataagcagttagttgtatgtgacagcaataccattagtgttgtcaattg |
85 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19206966 |
ttaatcaacatttataagcacttagttgtatgtgacagcaataccattagtgttgtcaattg |
19206905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 208 - 257
Target Start/End: Complemental strand, 19206608 - 19206559
Alignment:
| Q |
208 |
cttaccttcaccttgtctaggtacaactcaggcgcaattatctttctctg |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
19206608 |
cttaccttcaccttgtctaggtacaattcaggcgcgattatcttcctctg |
19206559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 141
Target Start/End: Complemental strand, 6586653 - 6586592
Alignment:
| Q |
79 |
tcaattgtggattgcgaagaaatagcgttttgtgcaaattccactatactatagttctatagc |
141 |
Q |
| |
|
|||||||||||||||| | |||||||| ||||| |||||||| |||| | ||||||||||||| |
|
|
| T |
6586653 |
tcaattgtggattgcgga-aaatagcggtttgttcaaattcctctatgcaatagttctatagc |
6586592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1337 times since January 2019
Visitors: 3228