View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0444_high_6 (Length: 398)

Name: NF0444_high_6
Description: NF0444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0444_high_6
NF0444_high_6
[»] chr3 (1 HSPs)
chr3 (11-352)||(45382144-45382475)


Alignment Details
Target: chr3 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 11 - 352
Target Start/End: Original strand, 45382144 - 45382475
Alignment:
11 cagagatataacaaacggtaaacacatccatgagatgcttctagcccctaccttgcataattatacataattgtttgtgagttgtaaacacaaaacgata 110  Q
    ||||||||||||||| ||||||||||||||||||          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
45382144 cagagatataacaaatggtaaacacatccatgag----------cccctaccttgcataattatacataattgttagtgagttgtaaacacaaaacgata 45382233  T
111 aatttgacaggggagaagaaattgaaatcgatacttgggtggatgcagcaggaaagaatggaatgcgaagagattggataatccgagatcgttgtaccaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45382234 aatttgacaggggagaagaaattgaaatcgatacttgggtggatgcagcaggaaagaatggaatgcgaagagattggataatccgagatcgttgtaccaa 45382333  T
211 agagatcataactaaagcaacaaggtgcattatttcatatacttttttatgcatccaaaatatgttatgatttataataccaaataatatgttaatagga 310  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45382334 agagatcataactaaagcaacaaggtgcattatttcatatacttttttatgcatccaaaatatgttatgatttataataccaaataatatgttaatagga 45382433  T
311 aactttgtctttgatacagcacatgggtgataatgaatagag 352  Q
    ||||||||||||||||||||||||||||||||||||||||||    
45382434 aactttgtctttgatacagcacatgggtgataatgaatagag 45382475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1328 times since January 2019
Visitors: 3228