View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0444_low_19 (Length: 218)
Name: NF0444_low_19
Description: NF0444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0444_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 6 - 122
Target Start/End: Original strand, 49531212 - 49531328
Alignment:
| Q |
6 |
aagtgagggttttagacggtcaaaaactttattagaatgagagaatgtattttttatcatgagtctgataccttgaataaattaggtgtaaaaagagtga |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49531212 |
aagtgagggttttagacggtcaaaaagtttattagaatgagagaatgtatcttttatcatgagtctgataccttgaataaattaggtgtaaaaagagtga |
49531311 |
T |
|
| Q |
106 |
tgatcaattgttgtgtg |
122 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49531312 |
tgatcaattgttgtgtg |
49531328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1347 times since January 2019
Visitors: 3228