View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445-Insertion-6 (Length: 304)
Name: NF0445-Insertion-6
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445-Insertion-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 8 - 304
Target Start/End: Original strand, 46813428 - 46813724
Alignment:
| Q |
8 |
cgcatatcccacctacaaagcctattatcatccaatccaagaaaagttgaacccgatggatccaattgtgcccctttactatcattggtgatatctttca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46813428 |
cgcatatcccacctacaaagcctattatcatccaatccaagaaaagttgaacccgatggatccaattgagcccctttactatcattggtgatatctttca |
46813527 |
T |
 |
| Q |
108 |
tggtaatctcagtaccatccttaccaaatctccattctgtcacaaccttaccagtctcaatatcaaactggtgaagccctgttgaatgaagtttgttttc |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46813528 |
ttgtaatctcagtaccatccttaccaaatctccattctgtcacaaccttaccagtctcaatatcaaactggtgaagccctgttgaatgaaatttgttttc |
46813627 |
T |
 |
| Q |
208 |
acccaatggactcatcagaagcatgctggtctcggctttcatgagaagcgttttcttgggagtgcaatccaccaacttcgatgttgaggacgaacca |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813628 |
acccaatggactcatcagaagcatgctggtctcggctttcatgagaagcgttttcttgggagtgcaatccaccaacttcgatgttgaggacgaacca |
46813724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 6 - 119
Target Start/End: Original strand, 33762688 - 33762801
Alignment:
| Q |
6 |
cacgcatatcccacctacaaagcctattatcatccaatccaagaaaagttgaacccgatggatccaattgtgcccctttactatcattggtgatatcttt |
105 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| || | ||| ||||| |||| ||||||||||||| ||||||| ||||||| |||||||| | |
|
|
| T |
33762688 |
cacgcatatcccattgacatagcctattatcatccaaccctaaaaatgttgactccgaaggatccaattgtgaccctttagtatcatttgtgatatccct |
33762787 |
T |
 |
| Q |
106 |
catggtaatctcag |
119 |
Q |
| |
|
||| ||||| |||| |
|
|
| T |
33762788 |
cattgtaatatcag |
33762801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University