View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445-Insertion-7 (Length: 245)
Name: NF0445-Insertion-7
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445-Insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 24875037 - 24874837
Alignment:
| Q |
10 |
ttcctcgcattaaagcagcatgaagagctcttagttccactgctttggctatagcaaccttaatttcctgtcttgtagtttctgagtttccattgttgtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24875037 |
ttcctcgcattaaagcagcatgaagagctcttagttccactgctttggctatagcaaccttaatttcctgtcttgtagtttctgagtttccattgttgtt |
24874938 |
T |
|
| Q |
110 |
gtctttgaaaacttgtgttgaagtatttgttgcagccatgaaacagaacagagaagcagaacaaaatggaacatgtaaatttcttgaagataataatatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24874937 |
gtctttgaaaacttgtgttgaagtatttgttgaagccatgaaacataacagagaaacagaacaaaatggaacatgtaaatttcttgaagataataatatt |
24874838 |
T |
|
| Q |
210 |
a |
210 |
Q |
| |
|
| |
|
|
| T |
24874837 |
a |
24874837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1163 times since January 2019
Visitors: 3419