View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_high_11 (Length: 238)
Name: NF0445_1D_high_11
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 231
Target Start/End: Complemental strand, 31535861 - 31535643
Alignment:
| Q |
7 |
ctttggctgttgaagctttcactggtgtcgcatggcaagatgctggaaaggtaccttttttattactccttttcattttcattcttgttattcaattata |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31535861 |
ctttggctgttgaagctttcactggtgtcgcatggcaagatgctggaaaggtaccttttttattactcctttt------cattgttgttattcaattata |
31535768 |
T |
 |
| Q |
107 |
gtcattgttcaatagagctatgttattgttgnnnnnnnataatnnnnnnntttagattagttgaatttcggattcattaaggtcaagaccaacattaaga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31535767 |
gtcattgttcaatagagctatgttattgttgtttttttataataaaaaaatttagatgagttgaatttcggattcattatggtcaagactaacattaaga |
31535668 |
T |
 |
| Q |
207 |
ttgaaagagcatttacaaacaccaa |
231 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
31535667 |
ttgaaagagcatttacaaacgccaa |
31535643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University