View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_high_9 (Length: 265)
Name: NF0445_1D_high_9
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 9 - 260
Target Start/End: Complemental strand, 47128872 - 47128621
Alignment:
| Q |
9 |
gagatgaacagtttggtcatgtaaagttttcagactttctagcttattcactcaaatccgtcactcaggttttgcttccagagcttagatctctgtgtga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128872 |
gagatgaacagtttggtcatgtaaagttttcagactttctagcttattcactcaaatccgtcactcaggttttgcttccagagcttagatctctgtgtga |
47128773 |
T |
|
| Q |
109 |
caaaactattaatgagtttgatacttttcaagatgtacttgatatttatgaaggaagttttaacctcccaagtggacctttgcatagtaaaatcagagac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47128772 |
caaaactattaatgagtttgatacttttcaagatgtacttgatatttatgaaggaagttttaacctcccaagtggacctttgcatagtaaaattagagac |
47128673 |
T |
|
| Q |
209 |
cttattccttatgagatttttagagaacttgttaggaatgatggtgagaaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47128672 |
cttattccttatgagatttttagagaacttgttaggaatgatggtgagaaat |
47128621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 132 times since January 2019
Visitors: 3270