View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_10 (Length: 354)
Name: NF0445_1D_low_10
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_low_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 34899475 - 34899827
Alignment:
| Q |
1 |
gggatctctttttcgtttaatataatttttgacttcttcaacnnnnnnnntctatgaagaagtgtctgctaagacttacaaataattagttggtagctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899475 |
gggatctctttttcgtttaatataatttttgacttcttcaacaaaaaaaatctatgaagaagtgtctgctaagacttacaaataattagttggtagctga |
34899574 |
T |
|
| Q |
101 |
atgcagaaaattgaatatcgaaaatgtgtctctaaaaatgttcttagttattaggagaacctcaattagtgggtcagttgacatgttccacttggttttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34899575 |
atgcagaaaattgaatatcgaaaatgtgtctctaaaaatgttcttagttattaggagaacctcaactagtgggtcagttgacatgttccacttggttttt |
34899674 |
T |
|
| Q |
201 |
atgcgtaacgtaccacacaagcatatgcaaatgttataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcac |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899675 |
atgcgtaa-gtaccacacaagcatatgcaaatgttataataagataggcaagagataccaaattatcatattgtcagtgatatcatctgcacaaattcac |
34899773 |
T |
|
| Q |
301 |
ataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaag |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899774 |
ataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaag |
34899827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3 times since January 2019
Visitors: 3264