View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_13 (Length: 321)
Name: NF0445_1D_low_13
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_low_13 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 23 - 209
Target Start/End: Original strand, 34892938 - 34893124
Alignment:
| Q |
23 |
actgtccataagcaaaagtatcccattcgaaaccaagggaaaggctgaaggagcaaaaggaagaagagtatgatttccatataagcacaaacaatggaag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34892938 |
actgtccataagcaaaagtatcccattcgaaaccaagggaaaggctgaaggagcaaaacgaagaagagtatgatttccatataagcacaaacaatggaag |
34893037 |
T |
 |
| Q |
123 |
tttagaattaaatggaattcaatgcaagaactcaccaggcaatttaaagctgtatcacctatgaggaaaatagcattgattgagtgc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34893038 |
tttagaattaaatggaattcaatgcaagaactcaccaggcaatttaaagctgtatcacctatgaggaaaatagcattgattgagtgc |
34893124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 204 - 321
Target Start/End: Complemental strand, 35072066 - 35071949
Alignment:
| Q |
204 |
gagtgcttcagataacaggagagaggagcatggagagacaagatacaaatgatggatgtcagcgtgttgagcgtagtagtggtaaattcatgaggagttt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35072066 |
gagtgcttcagataacaggagagaggagcatggagagacaagatacaaatgatggatgtcagcgtgttgagcgtagtagtggtaaattcatgaggagttt |
35071967 |
T |
 |
| Q |
304 |
tactcttccagctaactg |
321 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35071966 |
tactcttccagctaactg |
35071949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 43843074 - 43843127
Alignment:
| Q |
151 |
aactcaccaggcaatttaaagctgtatcacctatgaggaaaatagcattgattg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
43843074 |
aactcaccaggcaatttaaagctgtatctcctagcaggaaaacagcattgattg |
43843127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 63
Target Start/End: Original strand, 43842944 - 43842985
Alignment:
| Q |
22 |
aactgtccataagcaaaagtatcccattcgaaaccaagggaa |
63 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
43842944 |
aactgtccacaggcaaaagtatcctattcgaaaccaagggaa |
43842985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University