View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_14 (Length: 310)
Name: NF0445_1D_low_14
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 23332851 - 23332595
Alignment:
| Q |
1 |
ggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332851 |
ggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctg |
23332752 |
T |
 |
| Q |
101 |
acttatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatga |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332751 |
acgtatgtacagccgaatcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatga |
23332652 |
T |
 |
| Q |
201 |
ttgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccacatat |
257 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332651 |
ttgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 294
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
252 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
294 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 294
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
252 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
294 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University