View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_18 (Length: 271)
Name: NF0445_1D_low_18
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 12 - 178
Target Start/End: Original strand, 34899809 - 34899975
Alignment:
| Q |
12 |
tgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899809 |
tgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaag |
34899908 |
T |
 |
| Q |
112 |
aactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899909 |
aactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University