View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_20 (Length: 269)
Name: NF0445_1D_low_20
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_1D_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 233
Target Start/End: Complemental strand, 13742434 - 13742208
Alignment:
Q |
7 |
tgttctgacaacgttgttaaatcatgggttttcaattttatgtaaaatagattcacccatttttctcatggtaaattcccaagttacattacagcaatgc |
106 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
13742434 |
tgttctgacaacgttgtcaaatcatgggttttcaattttatgtaaaatagattcacccatttttctcatggtaaattcccaagttacattgcagcaatgc |
13742335 |
T |
 |
Q |
107 |
ttcacttttcaatttttgttaacggttgttgcagcttagtgatggttttgctgatacggattccaatacctcccgaagaggttgttacatttctgttgag |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
13742334 |
ttcacttttcaatttttgttaacggttgttgcagcttagtgatggttttgttgatacggattccaatacctcccgaagaggttgttgcatttctgttgag |
13742235 |
T |
 |
Q |
207 |
atgctgttttaaaggtgtgtatgtatg |
233 |
Q |
|
|
|||||||||| |||||||||||||||| |
|
|
T |
13742234 |
atgctgttttcaaggtgtgtatgtatg |
13742208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 158 - 237
Target Start/End: Complemental strand, 13734467 - 13734389
Alignment:
Q |
158 |
tgatacggattccaatacctcccgaagaggttgttacatttctgttgagatgctgttttaaaggtgtgtatgtatgaatt |
237 |
Q |
|
|
|||||| |||||||||||||| | |||||||| ||||| |||| |||||||| |||| | ||||| |||||| ||||||| |
|
|
T |
13734467 |
tgatactgattccaatacctctc-aagaggtttttacacttcttttgagatgttgttatcaaggtatgtatgaatgaatt |
13734389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University