View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_1D_low_23 (Length: 248)

Name: NF0445_1D_low_23
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_1D_low_23
NF0445_1D_low_23
[»] chr3 (1 HSPs)
chr3 (83-155)||(34899903-34899975)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 83 - 155
Target Start/End: Original strand, 34899903 - 34899975
Alignment:
83 gagatgaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat 155  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34899903 gagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat 34899975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 229 times since January 2019
Visitors: 3261