View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_27 (Length: 237)
Name: NF0445_1D_low_27
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_1D_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 21 - 137
Target Start/End: Original strand, 42667498 - 42667614
Alignment:
Q |
21 |
ctctctgcagcagtgttattttttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgta |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42667498 |
ctctctgcagcagtgttattttttgttttctcaatcttttcagattgatgcgtttctgatccttgcttcttcttgttctttcctttcaaagacgtgtgta |
42667597 |
T |
 |
Q |
121 |
cttcaatgtccttgatg |
137 |
Q |
|
|
||||||||||||||||| |
|
|
T |
42667598 |
cttcaatgtccttgatg |
42667614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 165 - 231
Target Start/End: Original strand, 42667642 - 42667708
Alignment:
Q |
165 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactgttcatctc |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42667642 |
aagtttaagtccaatccacgataacggttaacatgagtatcatcgctaaatcgccactgttcatctc |
42667708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 59 times since January 2019
Visitors: 3266