View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_34 (Length: 210)
Name: NF0445_1D_low_34
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_1D_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 5e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 2693262 - 2693074
Alignment:
Q |
16 |
tgtgtctgtccaatgtccatatctatgccaatgtttcatagatttatagtgatatgtaaaccatatgcatgtctcaatacctcaggaaatattgttgtga |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2693262 |
tgtgtctgtccaatgtccatatctatgccaatgtttcatagatttatagtgatatgtaaaccatatgcatgtctcaatacctcaggaaatattgttgtga |
2693163 |
T |
 |
Q |
116 |
ggtgattctcgcaatcactgattgttggcacttgacctcgaatggcagggagtttaccggccatgaagtcctgcacaaaacaatagtac |
204 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
2693162 |
ggtgattctcccaatcactgattgttggcacttgacctcgaatggcagggagtttaccggccatgaagtcctgcagaaaacaatagtac |
2693074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 94 - 191
Target Start/End: Complemental strand, 2685494 - 2685397
Alignment:
Q |
94 |
acctcaggaaatattgttgtgaggtgattctcgcaatcactgattgttggcacttgacctcgaatggcagggagtttaccggccatgaagtcctgcac |
191 |
Q |
|
|
||||||||| ||||||||| ||| ||||| || ||||| |||| |||||||| |||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
T |
2685494 |
acctcaggatatattgttgagagatgattttcccaatctctgagtgttggcaattgaccctgaaaagcagggagtttaccagccatgaagtcctgcac |
2685397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University