View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_1D_low_9 (Length: 361)
Name: NF0445_1D_low_9
Description: NF0445_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_1D_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 102 - 340
Target Start/End: Complemental strand, 40410570 - 40410330
Alignment:
| Q |
102 |
tgtacatataattatgattaa-ccgaaaga-tgattatatcttcactcctttaatctactcgctacccctaaaattgcctccctagctactagctggact |
199 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410570 |
tgtacatatgattatgattaagccgaaagagtgattatatcttcactcctttaatctactcgctacccctaaaattgcctccctagctactagctggact |
40410471 |
T |
|
| Q |
200 |
atatataccccacaaatattgtttgttttaagtcatacgatcacggatcacgtgaagtgtgattaattagcagtttctaacatcaacaacaagattaata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40410470 |
atatataccccacaaatattgtttgttttaagtcatacgatcacggatcacgtgaagtgtgattaattagccgtttctaacatcaacaacaagattaata |
40410371 |
T |
|
| Q |
300 |
tgcagactccgtatcatgattaattttgtcaagtataatat |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40410370 |
tgcagactccgtatcatgattaattttgtcaagtataatat |
40410330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 40410641 - 40410602
Alignment:
| Q |
44 |
aaaccaaaaataccaaaattgcattttaaaagatttaaca |
83 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40410641 |
aaaccaaaaataccagaattgcattttaaaagatttaaca |
40410602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 314 times since January 2019
Visitors: 3263