View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_2D_high_3 (Length: 299)

Name: NF0445_2D_high_3
Description: NF0445_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_2D_high_3
NF0445_2D_high_3
[»] chr7 (1 HSPs)
chr7 (7-281)||(49008834-49009108)


Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 7 - 281
Target Start/End: Original strand, 49008834 - 49009108
Alignment:
7 ttggtgtttaaggagaaaaatgaaaaggtggcatacaagttgaggatagaaggtcccaaaatggaggaaaataaagtagtttttgggtatctcacttgga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49008834 ttggtgtttaaggagaaaaatgaaaaggtggcatacaagttgaggatagaaggtcccaaaatggaggaaaataaagtagtttttgggtatctcacttgga 49008933  T
107 cagactcgaaacacaatgtcagaagtcccattgttgtgactagcctcaactcagaattaacacccccatagagcttaaagtgtttccttgaatattaatg 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49008934 cagactcgaaacacaatgtcagaagtcccattgttgtgactagcctcaactcagaattaacacccccatagagcttaaagtgtttccttgaatattaatg 49009033  T
207 attgcttaggttaagatgaggatattatgcttctaccaatccttgatttcatttttctcaattcatgaccagatc 281  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49009034 attgcttaggttaagatgaggatattatgcttctaccaatccttgatttcatttttctcaattcatgaccagatc 49009108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 128 times since January 2019
Visitors: 3258