View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_2D_low_11 (Length: 209)
Name: NF0445_2D_low_11
Description: NF0445_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_2D_low_11 |
 |  |
|
[»] chr4 (3 HSPs) |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 135 - 209
Target Start/End: Original strand, 7653859 - 7653933
Alignment:
Q |
135 |
tgtgaacattttttaggaggggcacttggcgctttacatttggtttggaactttgaattttgataaatagttttt |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7653859 |
tgtgaacattttttaggaggggcacttggcgctttacatttggtttggaactttgaattttgataaatagttttt |
7653933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 7653740 - 7653803
Alignment:
Q |
16 |
tggtgttcgattgagaacagtagtttgtctgggatttggtgttcgatggtggtgtttcacgagt |
79 |
Q |
|
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
7653740 |
tggtgttcgattgagaacaatggtttgtctgggatttggtgttcgatggtggtgtttcatgagt |
7653803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 209
Target Start/End: Original strand, 9110228 - 9110295
Alignment:
Q |
143 |
ttttttaggaggggcacttggcgctttacatttggtttg-gaactttgaattttgataaatagttttt |
209 |
Q |
|
|
||||||||||||| ||||||||||||| || |||||||| ||||||||||||||| ||||||||||| |
|
|
T |
9110228 |
ttttttaggagggacacttggcgctttgcacttggtttgaaaactttgaattttgacaaatagttttt |
9110295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 143 - 209
Target Start/End: Original strand, 40647078 - 40647144
Alignment:
Q |
143 |
ttttttaggaggggcacttggcgctttacatttggtttggaactttgaattttgataaatagttttt |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40647078 |
ttttttaggaggggcacttggcgctttacatttggtttggaactttgaattttgataaatagttttt |
40647144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 143 - 209
Target Start/End: Complemental strand, 22620305 - 22620239
Alignment:
Q |
143 |
ttttttaggaggggcacttggcgctttacatttggtttggaactttgaattttgataaatagttttt |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
T |
22620305 |
ttttttaggaggggcacttggcgctttacatttggtttggaactttaaattttaataaatagttttt |
22620239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 143 - 208
Target Start/End: Original strand, 7863938 - 7864004
Alignment:
Q |
143 |
ttttttaggaggggcacttggcgctttacatttggtttgg-aactttgaattttgataaatagtttt |
208 |
Q |
|
|
||||||||||||| |||||||| ||||||| ||||||||| ||||||||||||||| ||||| |||| |
|
|
T |
7863938 |
ttttttaggagggacacttggccctttacacttggtttggaaactttgaattttgacaaatactttt |
7864004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 65 times since January 2019
Visitors: 3266