View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_2D_low_7 (Length: 282)
Name: NF0445_2D_low_7
Description: NF0445_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_2D_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 117 - 262
Target Start/End: Original strand, 56165181 - 56165323
Alignment:
Q |
117 |
attctaatttttgcgaagttattgaatggataataagtacagaattttcaatattacaggcctggtttcattcctaccagcattaggaggaccatttgga |
216 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
56165181 |
attctaatttttgcgaagttattgaatggataataagtacagaattttcaatattacaggcctggtttcattcctaccagcatt---aggaccatttgga |
56165277 |
T |
 |
Q |
217 |
ttggtgtgactgctgcgattcctcttgttttgttcgtgcggttaag |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56165278 |
ttggtgtgactgctgcgattcctcttgttttgttcgtgcggttaag |
56165323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 35 - 124
Target Start/End: Original strand, 44262575 - 44262665
Alignment:
Q |
35 |
ttggtttgttatgttactaattggtgggatgtatgtgtat-tttaagtcccatttcagttatcggatggattggaatatgattattctaat |
124 |
Q |
|
|
||||||||||||| | |||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||| |||| |||||| |
|
|
T |
44262575 |
ttggtttgttatgccattaattgatgggatgtatgtgtatctttaagtcccatttcagttatcggatggataggaatagaattactctaat |
44262665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 134 times since January 2019
Visitors: 3258