View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_2D_low_7 (Length: 282)

Name: NF0445_2D_low_7
Description: NF0445_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_2D_low_7
NF0445_2D_low_7
[»] chr4 (1 HSPs)
chr4 (117-262)||(56165181-56165323)
[»] chr2 (1 HSPs)
chr2 (35-124)||(44262575-44262665)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 117 - 262
Target Start/End: Original strand, 56165181 - 56165323
Alignment:
117 attctaatttttgcgaagttattgaatggataataagtacagaattttcaatattacaggcctggtttcattcctaccagcattaggaggaccatttgga 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||    
56165181 attctaatttttgcgaagttattgaatggataataagtacagaattttcaatattacaggcctggtttcattcctaccagcatt---aggaccatttgga 56165277  T
217 ttggtgtgactgctgcgattcctcttgttttgttcgtgcggttaag 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
56165278 ttggtgtgactgctgcgattcctcttgttttgttcgtgcggttaag 56165323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 35 - 124
Target Start/End: Original strand, 44262575 - 44262665
Alignment:
35 ttggtttgttatgttactaattggtgggatgtatgtgtat-tttaagtcccatttcagttatcggatggattggaatatgattattctaat 124  Q
    |||||||||||||  | |||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||||  |||| ||||||    
44262575 ttggtttgttatgccattaattgatgggatgtatgtgtatctttaagtcccatttcagttatcggatggataggaatagaattactctaat 44262665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University