View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_1 (Length: 444)
Name: NF0445_low_1
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 154 - 344
Target Start/End: Original strand, 17243368 - 17243558
Alignment:
| Q |
154 |
gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgactgttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17243368 |
gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgtctgttg |
17243467 |
T |
 |
| Q |
254 |
gtggcactctctctaatgctgggattggtggtcaaacttttagatttggaccacaaatctccaatgttcttgaattggatgttatcacagg |
344 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17243468 |
gtggcactctctctaatgctggaattgggggccaaacttttagatttggaccacaaatctccaatgttcttgaattggatgttattacagg |
17243558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 166 - 290
Target Start/End: Original strand, 17275583 - 17275707
Alignment:
| Q |
166 |
gaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgactgttggtggcactctct |
265 |
Q |
| |
|
|||||| | ||||||||||| ||| ||| |||||| || ||||||| ||||| | |||||||||||||| | || || ||| |||| || || |||| |
|
|
| T |
17275583 |
gaacaactatggattgatgtgttgtatgaaacacttgagtatggacttgcacctgtttcttggactgattatctttacttaactattggagggacactct |
17275682 |
T |
 |
| Q |
266 |
ctaatgctgggattggtggtcaaac |
290 |
Q |
| |
|
|||||||||| ||| |||| ||||| |
|
|
| T |
17275683 |
ctaatgctggtattagtggacaaac |
17275707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 1e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 208 - 336
Target Start/End: Complemental strand, 52454656 - 52454528
Alignment:
| Q |
208 |
ggactcacacctctctcttggactgattacttgtatttgactgttggtggcactctctctaatgctgggattggtggtcaaacttttagatttggaccac |
307 |
Q |
| |
|
||||| ||||| || |||||||||||||| |||||||| | |||||||| ||||||||||||||||| ||| |||| ||||| || ||||||| || | |
|
|
| T |
52454656 |
ggacttacaccactttcttggactgattatttgtatttatcggttggtggaactctctctaatgctggtattagtggacaaaccttccgatttggtcctc |
52454557 |
T |
 |
| Q |
308 |
aaatctccaatgttcttgaattggatgtt |
336 |
Q |
| |
|
|||| |||||||||| ||||||||||||| |
|
|
| T |
52454556 |
aaatttccaatgttcatgaattggatgtt |
52454528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 52443410 - 52443489
Alignment:
| Q |
154 |
gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactga |
233 |
Q |
| |
|
||||| || ||||||||| | ||||||||||||||| |||| |||||| | |||||||| ||||| | ||||||||||| |
|
|
| T |
52443410 |
gatgttggaggagaacaactatggattgatgttttgtatgcaacacttgaacatggacttgcacctgtttcttggactga |
52443489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 223 - 290
Target Start/End: Complemental strand, 52630637 - 52630570
Alignment:
| Q |
223 |
tcttggactgattacttgtatttgactgttggtggcactctctctaatgctgggattggtggtcaaac |
290 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||| ||||||| ||| ||| |||| ||||| |
|
|
| T |
52630637 |
tcttggactgattacttgtatttgtctgtgggtggtactctatctaatggtggtattagtggccaaac |
52630570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University